Last week, the world learned of the first living organism that carries a synthetic genome. That that same genome contains the nucleic equivalents of both graffiti and poetry is less known…
Unless you’ve been avoiding science news for over a week, you’ve been bombarded by news of the creation of the first ‘synthetic cell’ by scientists from the J Craig Venter Institute. Venter’s team synthesized a functional and faithful copy of the Mycoplasma genome that we all know and love (it’s ok, I don’t really love goat parasites either). Mycoplasma has one of the smallest bacterial genomes known, making it a logical starting point for genomic synthesizing efforts.

Venter and colleagues spray painted their names all over the Mycoplasma genome. I wonder what Craig's tag looks like..
To prove that their genome is synthesized, the team had to sneak in so-called watermark sequences into the genome. These watermarks make it possible to tell that this genome was made by the hands of man, instead of nature. They could have treated this as just another biological control, inserting unique stretches of ‘gibberish’ nucleotides at random locations. Instead the scientists did what any respectable graffiti-artist would do: they developed a code and spray painted their names all over the genome!
But they didn’t leave it at that. From the press announcement:
Encoded in the watermarks is a new DNA code for writing words, sentences and numbers. In addition to the new code there is a web address to send emails to if you can successfully decode the new code, the names of 46 authors and other key contributors …
Did Craig Venter just announce the first DNA based scavenger hunt ever? If so, the ‘synthetic cell’ is unique in more than one way! What kind of code would the scientists concoct to encode their graffiti in?
Let’s suppose the Venter team wanted their code to cover every ASCII symbol. ASCII might be a bit antiquated, but it’s still the industry standard for coding the English alphabet into bits. Besides, if Chris really coded a website into his synthetic genome, he needs all the slashes and dots he can get! Since DNA has 4 nucleotides, using a quaternary numeral system seems the most logical and efficient choice.
For simplicity, let A = 0, C = 1, G = 2 and T = 3. We can now convert any character into DNA with an ASCII table. Let’s start to convert the character ‘C’ (from ‘Craig’ of course!). Capital C has decimal number 67, which would be ’1003′ in quaternary code (1*4^3+0*4^2+0*4^1+3*4^0 = 67), corresponding to ‘CAAT’ in nucleotides. I’m of course assuming that Venter’s team made the code relatively easy to crack, so that every molecular biologist is able to read Chris’ tags when they encounter one of his synthetic genomes in their sequencers.
So the string ‘Craig Venter’ becomes ‘CAATCTAGCGACCGGCCGCTAGAACCCGCGCCCGTGCTCACGCCCTAG”. I admit that’s a nightmare to fill into insurance forms, but it looks pretty cool nonetheless! But wait till you see what else they managed to cram into the tiny genome:
.. and three quotations: “TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE.” – JAMES JOYCE; “SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE.”-A quote from the book, “American Prometheus”; “WHAT I CANNOT BUILD, I CANNOT UNDERSTAND.” – RICHARD FEYNMAN.
It’s great to see scientists appreciate one of the most influential writers of the 20th century. But as Carl Zimmer rightly noted, these words will not be able to withstand evolution’s erosion. Since these quotes are located in intergenic regions, there is no pressure to keep them intact and mutations will slowly accumulate, perversing James Joyce’s words and Craig Venter’s name (I’ll leave it up to you to say what’s the greater loss). This is a nuisance for Venter’s team: how will they be able to permanently mark that a genome is their creation? For the rest of us it’s a reminder that while we can manipulate what nature gives us, it will never truly belong to us.
Nature doesn’t care much for poetry. Or graffiti, for that manner.
So there, I did it. I wrote about Craig’s new toy. However, I didn’t tell you that the world won’t end. I also didn’t tell you why this isn’t ‘synthetic life’, and definitely didn’t tell you what this research will mean for synthetic biology. All that has been covered by better writers, to whom I redirect you more than happily!
Gibson, D., Glass, J., Lartigue, C., Noskov, V., Chuang, R., Algire, M., Benders, G., Montague, M., Ma, L., Moodie, M., Merryman, C., Vashee, S., Krishnakumar, R., Assad-Garcia, N., Andrews-Pfannkoch, C., Denisova, E., Young, L., Qi, Z., Segall-Shapiro, T., Calvey, C., Parmar, P., Hutchison, C., Smith, H., & Venter, J. (2010). Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Science DOI: 10.1126/science.1190719
You might also like:
Great post! Information that I honestly didn’t know and proof that scientists do ‘geek’ like noone else :) And does lead to the fun question: if you synthesised a genome, what would your three quotes be?
Reminds me of these researchers who (apparently) found a new gene in their area of study and wanted to name it after a ‘Buffy the Vampire Slayer’ character. Unfortunately when they looked it up in the literature they found it had already been discovered. And named after a character in Star Trek.
Thanks =). I was too late to the party to say anything meaningful about the research itself.. All that had been said already!
That’s a great and fun question! I really should have asked that in the blogpost (and I have to credit Venter & Co… James Joyce’s really is a wonderfully appropriate pick!)..
On the topic of nerdy gene names: R2D2 and Sonic Hedgehog will always be my favourites!
[...] fossils don’t exist… Thoughtomics: Crabs expose colliding continents Thoughtomics: Graffiti and Poetry in a Synthetic Genome Thoughtomics: Cyanobacterial neurotoxin evolved billions of years ago Thoughtomics: Bashford Dean: [...]